Successfully Added to Cart
Customers also bought...
-
DNA/RNA Shield (50 ml)Cat#: R1100-50DNA/RNA Shield reagent is a DNA and RNA stabilization solution for nucleic acids in any biological sample. This DNA and RNA stabilization solution preserves the... -
DNA/RNA Shield SafeCollect Swab Collection Kit (1 ml fill) (1 collection kit)Cat#: R1160The DNA/RNA Shield SafeCollect Swab Collection Kit is a user-friendly collection kit for stabilizing the nucleic acid content of samples collected with a swab. DNA/RNA...
Region
Quick-ITS Plus NGS Library Prep Kit (UDI)
Highlights
- The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples.
- 100% automation ready with only a single PCR step and without the need for normalization.
- Real-time PCR enables absolute microbial copy number quantification.
Original Manufacturer
100% satisfaction guaranteed, read Our Promise
Innovated in California, Made in the USA
Region
Quick-ITS Plus NGS Library Prep Kit (UDI)
Highlights
- The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples.
- 100% automation ready with only a single PCR step and without the need for normalization.
- Real-time PCR enables absolute microbial copy number quantification.
Original Manufacturer
100% satisfaction guaranteed, read Our Promise
Innovated in California, Made in the USA
| Cat # | Name | Size | Price | Quantity |
|---|
| Cat # | Name | Size | Price | |
|---|---|---|---|---|
| D4302-5-10 | ZymoBIOMICS DNase/RNase Free Water | 10 ml | €34,70 | |
| D6305 | ZymoBIOMICS Microbial Community DNA Standard | 200ng | €127,30 | |
| D6306 | ZymoBIOMICS Microbial Community DNA Standard | 2000ng | €254,50 | |
Description
Performance
Technical Specifications
| Sample Input | Purified microbial DNA ≤100 ng, free of PCR inhibitors. |
|---|---|
| ITS Primer Sequences (adapters not shown) | ITS3f (GCATCGATGAAGAACGCAG, 19 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp). |
| Index Primers | Dual index (barcodes) to uniquely label samples. |
| Barcode Sequences | 10 bp barcodes, Available for download here (USA Only), or by visiting the Documentation section of the D6425 Product Page at www.zymoresearch.com. |
| Amplicon Size | The final amplicon size after 1-Step PCR (targeted amplification and barcode addition) is ~480 bp. |
| Sequencing Platform | Illumina MiSeq® without the need to add custom sequencing primers. Zymo Research recommends the MiSeq® Reagent Kit v3 (600-cycle). For assistance with sample sheet setup, see Appendix F. |
| Required Equipment | Microcentrifuge, plate spinner (centrifuge), 96-well real-time quantitative PCR system (SYBR Green compatible) or standard PCR system, and 96-well real-time PCR plates. |
Resources
Documents
FAQ
Purified total DNA from any organism free from PCR inhibitors. This system has been used by Zymo Research’s Microbiomics Services team to process samples from human, water, soil, food, plants, feces, biofilms, and much more.
The system has been tested with inputs as low as 100 femtograms with no significant impact to the performance of the kit.
This single PCR step combines targeted amplification of the microbial genome and the barcoding index PCR, which allows for a simple and fast workflow.
The combination of using Equalase™ qPCR Premix to yield roughly equal amounts of libraries and a carefully curated barcode index list results in similar raw sequencing reads across samples.
The ZymoBIOMICS® Microbial Community DNA Standard consists of purified DNA from 8 bacteria and 2 yeasts and is useful for assessing community profile bias. The ZymoBIOMICS® 16S/ITS qPCR Standard consists of a plasmid that has a single bacterial and single fungal target and is useful for quantifying copy number. Both are useful as positive controls for the library prep process.
Equalase™ amplification and the library prep design may cause some library products to not anneal well, causing a lack of a tight band. These libraries are perfectly fine because preparation for Illumina sequencing includes denaturing libraries into single strands.
The Quick-ITS™ Plus NGS Library Prep Kit (D6424) uses a combinatorial barcoding scheme, which combines 16 forward and 24 reverse indexes to provide 384 barcode combinations. The Quick-ITS™ Plus NGS Library Prep Kit (UDI) (D6425) uses 768 unique index sequences (384 forward, 384 reverse) to provide 384 completely unique barcode combinations. The Quick-ITS™ Plus NGS Library Prep Kit (UDI) (D6425) is also provided with the Equalase™ qPCR Premix pre-aliquoted into the primer plate, further reducing the amount of hands-on time required.
Workflow Generator
Build Your Custom Microbiome Workflow
A great tool to help build or complete your workflow with our comprehensive microbiome solutions!
Need help? Contact Us

