Successfully Added to Cart

Updated Cart Total: 0 items Subtotal: €0,00 EUR
View Cart

Customers also bought...

    Quick-16S/ITS Plus Kits | ITS2

    Quick-16S Plus NGS Library Prep Kits dramatically reduce the hands-on time required to prepare NGS sequencing libraries - no normalization required!

    Region

    Quick-ITS Plus NGS Library Prep Kit (UDI)

    Highlights

    • The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples.
    • 100% automation ready with only a single PCR step and without the need for normalization.
    • Real-time PCR enables absolute microbial copy number quantification.
    Zymo Research's 100% Satisfaction Guarantee

    Original Manufacturer

    Innovated in California, Made in the USA

    Satisfaction 100% guaranteed, read Our Promise

    Region

    Quick-ITS Plus NGS Library Prep Kit (UDI)

    Highlights

    • The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples.
    • 100% automation ready with only a single PCR step and without the need for normalization.
    • Real-time PCR enables absolute microbial copy number quantification.
    Zymo Research's 100% Satisfaction Guarantee

    Original Manufacturer

    Innovated in California, Made in the USA

    Satisfaction 100% guaranteed, read Our Promise

    Cat # Name Size Price Quantity
    D6425-PS1 Quick-ITS Plus NGS Library Prep Kit (UDI) with Primer Set 1 96 rxns €1.295,70
    - +
    D6425-PS2 Quick-ITS Plus NGS Library Prep Kit (UDI) with Primer Set 2 96 rxns €1.295,70
    - +
    D6425-PS3 Quick-ITS Plus NGS Library Prep Kit (UDI) with Primer Set 3 96 rxns €1.295,70
    - +
    D6425-PS4 Quick-ITS Plus NGS Library Prep Kit (UDI) with Primer Set 4 96 rxns €1.295,70
    - +
    Cat # Name Size Price
    D4302-5-10 ZymoBIOMICS DNase/RNase Free Water 10 ml €33,30
    D6305 ZymoBIOMICS Microbial Community DNA Standard 200ng €123,50
    D6306 ZymoBIOMICS Microbial Community DNA Standard 2000ng €247,10

    Description

    The Quick-ITS Plus NGS Library Prep Kit (UDI) is the fastest and simplest NGS library prep targeting the ITS region for high-throughput sequencing, now with unique dual indexing for improved barcode resolution. The automation-friendly protocol utilizes a single qPCR/PCR for combined targeted amplification and barcode addition using specially designed primers. After pooling by equal volume, a single clean-up of the final library is performed, rather than massive AMPure® bead-based clean-ups. Additional library quantification analysis such as TapeStation® analysis or gel electrophoresis are not necessary. With these features, the workflow dramatically reduces the hands-on time of library preparation to only 30 minutes.

    Performance

    Technical Specifications
    Sample Input Purified microbial DNA ≤100 ng, free of PCR inhibitors.
    ITS Primer Sequences (adapters not shown) ITS3f (GCATCGATGAAGAACGCAG, 19 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp).
    Index Primers Dual index (barcodes) to uniquely label samples.
    Barcode Sequences 10 bp barcodes, Available for download here (USA Only), or by visiting the Documentation section of the D6425 Product Page at www.zymoresearch.com.
    Amplicon Size The final amplicon size after 1-Step PCR (targeted amplification and barcode addition) is ~480 bp.
    Sequencing Platform Illumina MiSeq® without the need to add custom sequencing primers. Zymo Research recommends the MiSeq® Reagent Kit v3 (600-cycle). For assistance with sample sheet setup, see Appendix F.
    Required Equipment Microcentrifuge, plate spinner (centrifuge), 96-well real-time quantitative PCR system (SYBR Green compatible) or standard PCR system, and 96-well real-time PCR plates.

    Resources

    Documents


    FAQ

    Purified total DNA from any organism free from PCR inhibitors. This system has been used by Zymo Research’s Microbiomics Services team to process samples from human, water, soil, food, plants, feces, biofilms, and much more.

    The system has been tested with inputs as low as 100 femtograms with no significant impact to the performance of the kit.

    This single PCR step combines targeted amplification of the microbial genome and the barcoding index PCR, which allows for a simple and fast workflow.

    The combination of using Equalase™ qPCR Premix to yield roughly equal amounts of libraries and a carefully curated barcode index list results in similar raw sequencing reads across samples.

    The ZymoBIOMICS® Microbial Community DNA Standard consists of purified DNA from 8 bacteria and 2 yeasts and is useful for assessing community profile bias. The ZymoBIOMICS® 16S/ITS qPCR Standard consists of a plasmid that has a single bacterial and single fungal target and is useful for quantifying copy number. Both are useful as positive controls for the library prep process.

    Equalase™ amplification and the library prep design may cause some library products to not anneal well, causing a lack of a tight band. These libraries are perfectly fine because preparation for Illumina sequencing includes denaturing libraries into single strands.

    The Quick-ITS™ Plus NGS Library Prep Kit (D6424) uses a combinatorial barcoding scheme, which combines 16 forward and 24 reverse indexes to provide 384 barcode combinations. The Quick-ITS™ Plus NGS Library Prep Kit (UDI) (D6425) uses 768 unique index sequences (384 forward, 384 reverse) to provide 384 completely unique barcode combinations. The Quick-ITS™ Plus NGS Library Prep Kit (UDI) (D6425) is also provided with the Equalase™ qPCR Premix pre-aliquoted into the primer plate, further reducing the amount of hands-on time required.

    Workflow Generator

    Build Your Custom Microbiome Workflow

    A great tool to help build or complete your workflow with our comprehensive microbiome solutions!

    Need help? Contact Us